The short version of DAC fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-07-13. Anything still debated is marked as such rather than presented as settled.
CJC-1295 acts at the growth hormone-releasing hormone receptor, a G-protein-coupled receptor found on somatotroph cells in the anterior pituitary. Binding triggers a rise in cyclic AMP and calcium entry, which promotes release of stored growth hormone. Because the peptide mimics the body's own releasing hormone, it amplifies existing secretory pulses rather than driving continuous output. The size of the response therefore depends partly on the subject's own hormonal rhythm and feedback state.
The attached maleimide group explains the unusual duration of the DAC version. After injection it reacts with the thiol of cysteine-34 on serum albumin, forming a stable covalent bond. The resulting conjugate is too large for rapid kidney filtration and is shielded from many peptidases. Reported half-lives for this form reach several days, whereas the version without the group is cleared in roughly half an hour. That gap is the main pharmacological difference between the two.
Downstream of growth hormone, the liver and other tissues increase production of insulin-like growth factor 1, a mediator of many growth-promoting effects. Studies have documented elevated levels of both hormones after dosing, and the rise from the long-acting form persists longer than that produced by shorter-acting analogues. What remains unclear is whether sustained elevation of these markers translates into meaningful clinical benefit, and whether prolonged exposure carries risks that short trials could not detect.
The dividing feature between the two forms is a maleimide-based drug affinity complex, abbreviated DAC. In the DAC-bearing version, a linker attaches the peptide to serum albumin after administration, and that association slows removal from plasma. The version lacking DAC appears in catalogs as MOD GRF(1-29) or tetrasubstituted GRF(1-29). Because informal writing treats both as one item, comparisons drawn from such sources routinely blend measurements taken from two molecules with substantially different behavior.
Four amino acid substitutions separate the modified backbone from the parent GRF(1-29) sequence. These changes reduce recognition by dipeptidyl peptidase IV and related proteases, extending the interval before degradation. Development work in this area sought longer-acting GHRH analogs for endocrine investigation. Published descriptions treat the substitution set as a defining property of the core sequence, while the albumin-binding linker is described separately as an optional addition to that same backbone.
CJC-1295 is a synthetic peptide analog of growth hormone-releasing hormone, constructed on the 29-amino-acid fragment designated GRF(1-29). The name began as an internal development code during the 1990s and later spread through research supply catalogs and discussion forums. The molecule does not occur in nature; its sequence is engineered rather than isolated from tissue. Two related compounds are sold under this single label, and they differ by one appended chemical group that strongly influences how long the peptide remains in circulation.
| Property | Value | Notes |
|---|---|---|
| Primary target | GHRH receptor | G-protein-coupled receptor on pituitary somatotrophs |
| Half-life, long-acting form | Several days | Extended by covalent albumin binding |
| Half-life, short form | About 30 minutes | Cleared rapidly by peptidases and kidneys |
| Route in studies | Subcutaneous injection | Used in the published human trials |
| Main measured effect | Rise in GH and IGF-1 | Surrogate markers rather than clinical endpoints |
At the pituitary, the peptide binds the growth hormone-releasing hormone receptor on somatotroph cells. Receptor activation raises intracellular cyclic AMP and triggers release of stored growth hormone. Somatostatin and other hypothalamic signals modulate this response. Negative feedback from insulin-like growth factor 1 also influences output. The same regulatory architecture operates with the native hormone. Whether the synthetic analog alters feedback dynamics over repeated exposure remains an open question. Most published receptor work uses cell models rather than intact human systems.
CJC-1295 is a synthetic peptide belonging to the growth hormone-releasing hormone analog family. It comprises twenty-nine amino acid residues derived from the N-terminal region of natural GHRH. The molecule incorporates several non-natural substitutions that increase resistance to enzymatic degradation. These modifications extend its activity compared with the native hormone fragment. Researchers use it to study pituitary growth hormone secretion in laboratory and clinical settings. This compound is distinct from native GHRH in its stability profile.
Two principal forms appear in the literature and in research supply. One carries a drug affinity complex, a maleimide-based group that forms a covalent bond with circulating albumin. This linkage slows clearance and produces a long-lasting elevation of peptide levels. The other form lacks that group and is often labeled MOD GRF(1-29). It has a much shorter circulation time. Both variants retain the same core receptor-binding sequence. Reported half-lives differ substantially between the two.
Lyophilized peptide powder is comparatively stable when kept dry, cold, and protected from light. Once dissolved, the molecule is vulnerable to deamidation, oxidation, and aggregation, with the rate depending on pH, buffer composition, and temperature. Alkaline conditions and repeated freeze-thaw cycles accelerate loss of the intact peptide. The methionine present in the native sequence is a known oxidation site, which is one reason it was replaced in the modified fragment. Suppliers typically recommend cold storage of solutions and use within a short window.
Analytical confirmation usually relies on reversed-phase high-performance liquid chromatography for purity and on liquid chromatography coupled to mass spectrometry for identity. Mass data reveal the expected molecular mass and can flag truncated or oxidized species. Amino acid analysis and peptide mapping provide sequence-level verification. Immunoassays are used in some biological matrices, but antibodies raised against one releasing-hormone analog may cross-react with another. Reported purity figures depend heavily on the method used, so comparisons between suppliers require matching the analytical approach.
== Related odiferous compounds == Stench compounds have unpleasant odors. Some are used as odorizer or an odorant usually have an intense odor, which may be pleasant or not. They are sometimes used to confer a detectable odor to an odorless substance, like propane, natural gas, or hydrogen, as a safety measure.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
=== Breast changes === Spironolactone can cause breast pain and enlargement in women. This is "probably because of estrogenic effects on target tissue." At low doses, breast tenderness has been reported in only 5% of women, but at high doses, it has been reported in up to 40% of women. Breast enlargement and tenderness may occur in 26% of women at high doses. Some women regard spironolactone-induced breast enlargement as a positive effect. Spironolactone also commonly and dose-dependently produces gynecomastia (breast development) as a side effect in men. At low doses, the rate is only 5 to 10%, but at high doses, up to or exceeding 50% of men may develop gynecomastia. In the RALES, 9.1% of men taking 25 mg/day spironolactone developed gynecomastia, compared to 1.3% of controls. Conversely, in studies of healthy men given high-dose spironolactone, gynecomastia occurred in 3 of 10 (30%) at 100 mg/day, in 5 of 8 (62.5%) at 200 mg/day, and in 6 of 9 (66.7%) at 400 mg/day, relative to none of 12 controls. The severity of gynecomastia with spironolactone varies considerably, but is usually mild. As with breast enlargement caused by spironolactone in women, gynecomastia due to spironolactone in men is often, although inconsistently, accompanied by breast tenderness. In the RALES, only 1.7% of men developed breast pain, relative to 0.1% of controls. The time to onset of spironolactone-induced gynecomastia has been found to be 27 ± 20 months at low doses and 9 ± 12 months at high doses.
=== 11 May === The Ukrainian army said that they had broken through advancing Russian formations northwest of Bakhmut. Geolocated footage showed Ukrainian troops counterattacking near Khromove and Bila Hora, which Russian forces were trying to seize in order to encircle the city. Ukrainian sources said their forces advanced 2.6 km (1.6 mi) along a 3 km-wide (1.9-mile) front, destroying the 6th and 8th companies of the Russian 72nd Separate Motor Rifle Brigade; the head of the Wagner Group, Yevgeny Prigozhin, said already on 9 May that Russian troops had abandoned some positions on his flank in Bakhmut. The claim was also shared by Russian military bloggers but denied by the Russian Defence Ministry, which said that Russian forces repelled a surge of Ukrainian attacks in Soledar and that its forces had fallen back to "more favourable positions" near the Berkhivka reservoir northwest of Bakhmut for tactical reasons. The United Kingdom Secretary for Defence Ben Wallace announced that the UK supplied Ukraine with Storm Shadow missiles. With a range of 250 kilometres, the missiles are capable of hitting targets in Crimea from the positions currently held by Ukraine. The United States supported the UK's decision.
Sources: en.wikipedia.org
=== Addition of carboxylic acids to alkenes and alkynes === In hydroesterification, alkenes and alkynes insert into the O−H bond of carboxylic acids. Vinyl acetate is produced industrially by the addition of acetic acid to acetylene in the presence of zinc acetate catalysts:
== Indications == The main effects of paregoric are to increase the muscular tone of the intestine, to inhibit normal peristalsis, and as an expectorant; a peer-reviewed clinical study in 1944 reported "that all of [its] ingredients have been found to contribute toward the expectorant action of paregoric, and, further, that an advantage is contained in the combination over the sum of the effects of the individual constituents," that Paregoric "is expectorant by virtue of a reflex from the stomach," and "preparations of paregoric which have aged for two or three years are superior as an expectorant to preparations aged for less time.". Its main medical use is to control fulminant diarrhea, and as an antitussive (cough suppressant). Problems with its use include opiate dependency and analgesia which can mask symptoms of diseases that need treatment. However, paregoric was characterized as "a needlessly complex pharmacopeial mixture... of a former day" by a 1966 study. In the 21st century its two main uses have been largely supplanted by minimally psychoactive cough-suppressant drugs (such as dextromethorphan) and non-psychoactive antidiarrheal drugs (such as loperamide).
Biden was consistently ranked one of the least wealthy members of the Senate, which he attributed to having been elected young. Feeling that less-wealthy public officials may be tempted to accept contributions in exchange for political favors, he proposed campaign finance reform measures during his first term. While a senator, Biden was viewed as being close to the credit card company MBNA, a major contributor to his campaigns since 1989, sometimes being called the "senator from MBNA". As of November 2009, Biden's net worth was $27,012. By November 2020, the Bidens were worth $9 million, largely due to sales of Biden's books and speaking fees after his vice presidency. Political columnist David S. Broder wrote that Biden has grown over time: "He responds to real people—that's been consistent throughout. And his ability to understand himself and deal with other politicians has gotten much, much better." Journalist James Traub has written that "Biden is the kind of fundamentally happy person who can be as generous toward others as he is to himself". Particularly since the 2015 death of his elder son Beau, Biden has been noted for his empathetic nature and ability to communicate about grief. Journalist and TV anchor Wolf Blitzer has called Biden loquacious; journalist Mark Bowden has said that he is famous for "talking too much", leaning in close "like an old pal with something urgent to tell you". He often deviates from prepared remarks, and sometimes "puts his foot in his mouth". Biden has a reputation for being prone to gaffes.
The four substrates of this enzyme are indole-3-pyruvic acid, reduced nicotinamide adenine dinucleotide phosphate (NADPH), oxygen, and a proton. Its products are indole-3-acetic acid, oxidised NADP+, water, and carbon dioxide. The starting material is produced from the amino acid, tryptophan, by action of the enzyme L-tryptophan—pyruvate aminotransferase. The product of the reaction is the main auxin plant hormone.
=== Muscle spindles === Poppele and Bowman used linear system theory to model mammalian muscle spindles Ia and II afferents. They recorded from a set of muscle spindles devoid of fusimotor action, measured their response to a series of sinusoidal and step function stretches, and fit a transfer function to the spike rate. They found that the following Laplace transfer function describes the firing rate responses of the primary sensory fibers for a change in length:
Sources: en.wikipedia.org
It binds the growth hormone-releasing hormone receptor on pituitary somatotroph cells. Receptor activation raises cyclic AMP and promotes release of stored growth hormone granules. Because the peptide persists longer than natural releasing hormone, stimulation is prolonged rather than brief.
The drug affinity complex links the peptide to serum albumin through a covalent bond. The conjugate is too large to be filtered quickly by the kidneys and is shielded from enzymatic breakdown. This extends the apparent half-life from roughly minutes to several days.
Long-term safety and any clinical benefit are unestablished. Published human data cover small groups over limited periods and focus on hormone levels rather than health outcomes. Whether prolonged elevation of growth hormone and insulin-like growth factor 1 is beneficial or harmful is an open question.
No. It is a laboratory-synthesized analog built on a fragment of the natural hormone. The natural peptide is shorter-lived and lacks the stabilizing substitutions found in the synthetic version.